Encomenda rápida

Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human HNRNPR Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1911bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens heterogeneous nuclear ribonucleoprotein R with N terminal Myc tag.
Sinónimo de gene:FLJ25714, HNRPR, hnRNP R, hnRNP-R, HNRNPR
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14309-ACG$245
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14309-ACR$245
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14309-ANG$245
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14309-ANR$245
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14309-CF$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14309-CH$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14309-CM$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14309-CY$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de expressão)HG14309-G$75
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14309-NF$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14309-NH$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14309-NM$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14309-NY$215
Humano HNRNP R / HNRNPR clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14309-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

HNRNP R, also known as HNRNPR, is a RNA binding protein. HNRNP R gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). HnRNPs complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. HNRNP R has three repeats of quasi-RRM domains that bind to RNAs and also contains a nuclear localization motif.

  • Rossoll, et al. (2002) Specific interaction of Smn, the spinal muscular atrophy determining gene product, with hnRNP-R and gry-rbp/hnRNP-Q: a role for Smn in RNA processing in motor axons?. Hum Mol Genet. 11 (1):93-105.
  • Mourelatos, Z, et al. (2001) SMN interacts with a novel family of hnRNP and spliceosomal proteins. EMBO J. 20(19):5443-52.
  • Hassfeld W, et al. (1998) Molecular definition of heterogeneous nuclear ribonucleoprotein R (hnRNP R) using autoimmune antibody: immunological relationship with hnRNP P. Nucleic Acids Res. 26(2):439-45.
  • Size / Price
    Catálogo: HG14309-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.