Encomenda rápida

Text Size:AAA

Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human HIST1H3A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:411bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens histone cluster 1, H3a with N terminal Flag tag.
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11231-ACG$225
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11231-ACR$225
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11231-ANG$225
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11231-ANR$225
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11231-CF$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11231-CH$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11231-CM$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11231-CY$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de expressão)HG11231-M$75
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11231-NF$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11231-NH$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11231-NM$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11231-NY$195
Humano HIST1H3A clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11231-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Histone H3.1, also known as HIST1H3A, HIST1H3B, HIST1H3C, HIST1H3D, HIST1H3E, HIST1H3F, HIST1H3G, HIST1H3H, HIST1H3I, HIST1H3J, is a member of the histone H3 family which is a core component of nucleosome. It is expressed during S phase, then expression strongly decreases as cell division slows down during the process of differentiation. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures.

  • Lachner M, et al., 2001, Nature 410 (6824): 116-20.
  • Koessler H, et al., 2003, DNA Cell Biol. 22 (4): 233-41.
  • Macdonald N. et al., 2005, Mol. Cell 20: 199-211.
  • Hyllus D. et al., 2007, Genes Dev. 21: 3369-3380.
  • Garcia BA. et al., 2007, J. Biol. Chem. 282:7641-7655.
  • Yu L.-R. et al., 2007, J. Proteome Res. 6: 4150-4162.
  • Size / Price
    Catálogo: HG11231-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.