Encomenda rápida

Text Size:AAA

Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human HGF Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2181bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens hepatocyte growth factor (hepapoietin A; scatter factor) with C terminal His tag.
Sinónimo de gene:SF, HGFB, HPTA, F-TCF, HGF
Local de restrição:KpnI (two restriction sites) + XbaI (6kb+2.18kb+0.06kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human HGF Gene Plasmid Map
Human HGF natural ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10463-ACG$245
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10463-ACR$245
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10463-CF$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10463-CH$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10463-CM$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10463-CY$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de expressão)HG10463-M$75
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10463-NF$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10463-NH$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10463-NM$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10463-NY$215
Humano HGF/Hepatocyte Growth Factor clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10463-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

Hepatocyte growth factor, also known as HGF, contains 4 kringle domains, 1 PAN domain and 1 peptidase S1 domain. It belongs to the peptidase S1 family, plasminogen subfamily. Hepatocyte growth factor is secreted by mesenchymal cellsas a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule. Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-Met receptor, and acts as a multi-functional cytokine on cells of mainly epithelial origin. Its ability to stimulate mitogenesis, cell motility, and matrix invasion gives it a central role in angiogenesis, tumorogenesis, and tissue regeneration. HGF is a potent mitogen for mature parenchymal hepatocyte cells, seems to be an hepatotrophic factor, and acts as growth factor for a broad spectrum of tissues and cell types. HGF has no detectable protease activity. Defects in hepatocyte growth factor are the cause of deafness autosomal recessive type 39. A form of profound prelingual sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

  • Naldini L, et al. (1991) Scatter factor and hepatocyte growth factor are indistinguishable ligands for the MET receptor. EMBO J. 10(10):2867-78.
  • Comoglio, et al. (1993) Structure, biosynthesis and biochemical properties of the HGF receptor in normal and malignant cells. 65:131-65.
  • Hahn W, et al. (2011) Enhanced cardioprotective effects by coexpression of two isoforms of hepatocyte growth factor from naked plasmid DNA in a rat ischemic heart disease model. The Journal of Gene Medicine. 13(10):549-55.
  • Bottaro DP, et al. (1991) Identification of the hepatocyte growth factor receptor as the c-met proto-oncogene product. Science. 251(4995):802-4.
  • Size / Price
    Catálogo: HG10463-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    • Human HGF natural ORF mammalian expression plasmid, C-His tag
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.