Encomenda rápida

Humano HEXA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

  • Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5620
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano HEXA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000520
Tamanho de cDNA:1635 bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens hexosaminidase A (alpha polypeptide) with C terminal His tag.
Sinónimo de gene:HEXA
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:pCMV3-HEXA-His
Local de restrição:HindIII + XbaI(6kb+1.64kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1518A/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with HEXA qPCR primers for gene expression analysis, HP101571 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Referências
  • Norflus,F. et al., 1996, DNA Cell Biol. 15 (2):89-97.
  • Kaufman M., et al., 1997, Hum. Mutat. 10:295-300.
  • Tanaka A., et al., 2003, J. Hum. Genet. 48:571-574.
  • Chen R., et al., 2009, J. Proteome Res. 8:651-661.
  • Burkard T.R., et al., 2011, BMC Syst. Biol. 5:17-17.
  • Size / Price
    Catálogo: HG12037-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"