After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human HBB Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000518
Tamanho de cDNA:444bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens hemoglobin, beta.
Sinónimo de gene:CD113t-C, HBD, beta-globin
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-HBB
Local de restrição:KpnI + XbaI (6.1kb + 0.44kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human HBB Gene Plasmid Map
Human HBB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12016-ACG$225
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12016-ACR$225
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12016-ANG$225
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12016-ANR$225
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12016-CF$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12016-CH$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12016-CM$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12016-CY$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de expressão)HG12016-G$75
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12016-NF$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12016-NH$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12016-NM$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12016-NY$195
Humano HBB/hemoglobin-beta clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12016-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG12016-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
  • Human HBB Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"