After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human GSTA1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC053578
Tamanho de cDNA:669bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens glutathione S-transferase alpha 1 DNA.
Sinónimo de gene:GST2, GTH1, GSTA1-1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15237-ACG$225
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15237-ACR$225
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15237-ANG$225
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15237-ANR$225
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15237-CF$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15237-CH$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15237-CM$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15237-CY$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG15237-G$75
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15237-G-F$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15237-NF$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15237-NH$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15237-NM$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15237-NY$195
Humano GSTM3 / GST2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15237-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15237-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"