Encomenda rápida

Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano GOT1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC000498
    Tamanho de cDNA:1242bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
    Sinónimo de gene:ASTQTL1, GIG18, GOT1
    Espécie:Human
    Vetor:pCMV3-N-HA
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GOT1 qPCR primers for gene expression analysis, HP102847 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14196-ACG$225
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14196-ACR$225
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14196-ANG$225
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14196-ANR$225
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14196-CF$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14196-CH$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14196-CM$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14196-CY$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14196-G$75
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14196-NF$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14196-NH$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14196-NM$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14196-NY$195
    Humano Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14196-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

    Referências
  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catálogo: HG14196-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"