After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human GOPC Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC009553
Tamanho de cDNA:1365bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens golgi-associated PDZ and coiled-coil motif containing with N terminal Myc tag.
Sinónimo de gene:CAL, FIG, PIST, GOPC1, dJ94G16.2
Espécie:Human
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14911-ACG$225
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14911-ACR$225
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14911-ANG$225
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14911-ANR$225
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14911-CF$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14911-CH$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14911-CM$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14911-CY$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de expressão)HG14911-G$75
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14911-NF$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14911-NH$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14911-NM$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14911-NY$195
Humano GOPC / PIST clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14911-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

GOPC, also known as PIST, interacts specifically with TC10 (a Rho-family small GTPase)] as a binding partner for Rhotekin. Rhotekin associates with PIST in vitro and in both polarized and non-polarized MDCK (Madin-Darby canine kidney) cells. The C-terminal SPV (Ser-Pro-Val) motif of Rhotekin binds to the PDZ domain of PIST. The co-localization of PIST and Rhotekin at the Golgi apparatus can be detected in non-polarized fibroblast-like MDCK cells and AJs (adherens junctions) in the fully polarized cells. PIST and Rhotekin are recruited from the cytosol to AJs as the cell becomes polarized. Expression of constitutively active Rho or prevention of Rhotekin-PIST interaction induced diffuse cytoplasmic distribution of Rhotekin in polarized MDCK cells. GOPC may regulate CFTR chloride currents and acid-induced ACCN3 currents by modulating cell surface expression of both channels. It may also regulate the intracellular trafficking of the ADR1B receptor. GOPC is ubiquitously expressed and its overexpression results in CFTR intracellular retention and degradation in the lysosomes.

Referências
  • Hicks SW. et al., 2005, J Biol Chem. 280 (32): 28944-51.
  • Ito H. et al., 2006, Biochem J Aug. 397 (3): 389-98.
  • Amin N. et al., 2012, Mol Psychiatry. 17 (11): 1116-29.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"