Encomenda rápida

Text Size:AAA

Humano alpha-Galactosidase A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human GLA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1290bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens galactosidase, alpha with C terminal HA tag.
Sinónimo de gene:GALA
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano alpha-Galactosidase A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Product nameProduct name

Alpha-galactosidase A, also known as Alpha-D-galactoside galactohydrolase, Alpha-D-galactosidase A, Melibiase and GLA, is a member of the glycosyl hydrolase 27 family. GLA is used as a long-term enzyme replacement therapy in patients with a confirmed diagnosis of Fabry disease. Defects in GLA are the cause of Fabry disease (FD) which is a rare X-linked sphingolipidosis disease where glycolipid accumulates in many tissues. The disease consists of an inborn error of glycosphingolipid catabolism. FD patients show systemic accumulation of globotriaoslyceramide (Gb3) and related glycosphingolipids in the plasma and cellular lysosomes throughout the body. Clinical recognition in males results from characteristic skin lesions (angiokeratomas) over the lower trunk. Patients may show ocular deposits, febrile episodes, and burning pain in the extremities. Death results from renal failure, cardiac or cerebral complications of hypertension or other vascular disease. Deficiency of GLA leads to the accumulation of glycosphingolipids in the vasculature leading to multiorgan pathology. In addition to well-described microvascular disease, deficiency of GLA is also characterized by premature macrovascular events such as stroke and possibly myocardial infarction.

  • Koide T.et al., 1990, FEBS Lett. 259:353-356.
  • Yang C.-C. et al., 2003, Clin. Genet. 63:205-209.
  • Verovnik F. et al.,2004, Eur. J. Hum. Genet. 12:678-681.
  • Nance C.S. et al., 2006, Arch. Neurol. 63:453-457.
  • Size / Price
    Catálogo: HG12078-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.