After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human GIF Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC037958
Tamanho de cDNA:1254bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens gastric intrinsic factor (vitamin B synthesis) with C terminal Myc tag.
Sinónimo de gene:IF, INF, IFMH, TCN3, GIF
Espécie:Human
Vetor:pCMV3-C-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13544-ACG$225
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13544-ACR$225
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13544-CF$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13544-CH$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13544-CM$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13544-CY$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de expressão)HG13544-G$75
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13544-NF$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13544-NH$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13544-NM$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13544-NY$195
Humano Gastric intrinsic factor / GIF clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13544-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Gastric intrinsic factor, also known as GIF, belongs to the of the cobalamin transport protein family. It is a glycoprotein produced by the parietal cells of the stomach. Gastric intrinsic factor plays a key role in the absorption of vitamin B12 on in the small intestine. Vitamin B12 bounds to haptocorrin after entry into the stomach. The resulting complex enters the duodenum, where pancreatic enzymes digest haptocorrin. In the less acidic environment of the small intestine, B12 can then bind to gastric intrinsic factor. This new complex travels to the ileum, where special epithelial cells endocytose them. Inside the cell, B12 dissociates once again and binds to another protein, transcobalamin II. The new complex can exit the epithelial cells to enter the liver.

Referências
  • Gerdin AK. (2010) The Sanger Mouse Genetics Programme: high throughput characterisation of knockout mice. Acta Opthalmologica. 88:925-7.
  • AU - Berlin H, et al. (1968) ORAL TREATMENT OF PERNICIOUS ANEMIA WITH HIGH DOSES OF VITAMIN B12 WITHOUT INTRINSIC FACTOR. Acta Medica Scandinavica. 184(1-6):247-58.
  • Hewitt JE, et al. (1991) Human gastric intrinsic factor: characterization of cDNA and genomic clones and localization to human chromosome 11. Genomics. 10(2):432-40.
  • Size / Price
    Catálogo: HG13544-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"