After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human GADD45A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001924.2
Tamanho de cDNA:498bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens growth arrest and DNA.-damage-inducible, alpha with C terminal HA tag.
Sinónimo de gene:DDIT1, GADD45, GADD45A
Espécie:Human
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11156-ACG$225
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11156-ACR$225
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11156-ANG$225
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11156-ANR$225
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11156-CF$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11156-CH$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11156-CM$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11156-CY$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11156-M$75
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11156-NF$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11156-NH$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11156-NM$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11156-NY$195
Humano GADD45A/DDIT1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11156-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

GADD45A is a member of the GADD45 Family, and has been found to associate with several cytoplasmic and nuclear factors and has been implicated in several cellular functions, including MAPK signaling, cell cycle regulation, DNA repair and genomic stability, apoptosis, and immune responses. The GADD45 Family of genes is rapidly induced by different stressors, including differentiation-inducing cytokines, and there is a large body of evidence that their cognate proteins are key players in cellular stress responses. GADD45A protein has been reported to interact with multiple important cellular proteins, including Cdc2 protein kinase, proliferating cell nuclear antigen (PCNA), p21Waf1/Cip1 protein, core histone protein and MTK/MEKK4, an up-stream activator of the JNK/SAPK pathway, indicating that GADD45A may play important roles in the control of cell cycle checkpoint, DNA repair process, and signaling transduction. GADD45A expression in response to genotoxic stress illustrates a more complex scenario, wherein transcriptional changes operate in concert with mRNA turnover and translational regulation. GADD45A was the first stress-inducible gene determined to be up-regulated by p53 and is also a target for the p53 homologues, p63 and p73. The decreased GADD45A expression is also considered a survival mechanism, as cancer cells without this control can evade the apoptotic pathway leading to increased tumourigenesis. As GADD45A is an essential component of many metabolic pathways that control proliferating cancer cells, it presents itself as an emerging drug target worthy of further investigation.

Referências
  • Zhan Q. (2005) Gadd45a, a p53- and BRCA1-regulated stress protein, in cellular response to DNA damage. Mutat Res. 569(1-2): 133-43.
  • Lal A, et al. (2006) Egad, more forms of gene regulation: the gadd45a story. Cell Cycle. 5(13): 1422-5.
  • Hoffman B, et al. (2007) Role of gadd45 in myeloid cells in response to hematopoietic stress. Blood Cells Mol Dis. 39(3): 344-7.
  • Rosemary Siafakas A, et al. (2009) Growth arrest and DNA damage-45 alpha (GADD45alpha). Int J Biochem Cell Biol. 41(5): 986-9.
  • Size / Price
    Catálogo: HG11156-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"