After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human FZD1 natural ORF mammalian expression plasmid

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FZD1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_003505.1
Tamanho de cDNA:1944bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens frizzled family receptor 1 DNA.
Sinónimo de gene:FLJ95923, DKFZp564G072, FZD1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Fundo

Frizzled-1, also known as FZD1, belongs to the G-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.

Size / Price
Catálogo: HG15229-UT
Preço de catálogo:   (Save )
Preço:      [How to order]
Disponibilidade2-3 weeks
 Instruções de envio
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"