After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FUOM Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001098483.1
Tamanho de cDNA:465bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens fucose mutarotase with N terminal Flag tag.
Sinónimo de gene:FUCU, FucM, C10orf125
Espécie:Human
Vetor:pCMV3-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13974-ACG$225
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13974-ACR$225
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13974-ANG$225
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13974-ANR$225
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13974-CF$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13974-CH$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13974-CM$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13974-CY$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de expressão)HG13974-G$75
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13974-NF$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13974-NH$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13974-NM$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13974-NY$195
Humano FUOM / fucose mutarotase / FucM clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13974-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

FUOM, also known as fucose mutarotase and FucM, belongs to the RbsD / FucU family. FUOM is involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose has two isforms: alpha-L-fucose (29.5%) and beta-L-fucose (70.5%). The beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes. FUOM mainly exists as homodimer, but also functions as homotetramer, homooctamer, and homodecamer. FUOM's homodimeric form seems catalytically inactive.

Referências
  • Deloukas P. et al., 2004, Nature. 429: 375-81.
  • Ota T. et al., 2004, Nat Genet. 36: 40-5.
  • Dongkyu Park. et al., 2007, Glycobiology. 17 (9): 955-62.
  • Size / Price
    Catálogo: HG13974-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"