After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human FKBPL natural ORF mammalian expression plasmid

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FKBPL Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC004168
Tamanho de cDNA:1050bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens FK506 binding protein like.
Sinónimo de gene:DADB-220I18.2, DIR1, NG7, WISP39, FKBPL
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catálogo: HG14215-UT
Preço de catálogo:   (Save )
Preço:      [How to order]
Disponibilidade2-3 weeksInstruções de envio
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"