Encomenda rápida

Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FILIP1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:3642bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens filamin A interacting protein 1 with C terminal His tag.
Sinónimo de gene:FILIP, KIAA1275, FILIP1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10444-ACG$375
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10444-ACR$375
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10444-ANG$375
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10444-ANR$375
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10444-CF$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10444-CH$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10444-CM$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10444-CY$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de expressão)HG10444-M$75
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10444-M-F$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10444-NF$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10444-NH$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10444-NM$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10444-NY$345
Humano FLIP/CFLAR clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10444-UT$345
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10444-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.