Encomenda rápida

Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano FHIT Informações sobre o produto de clone de cDNA
Tamanho de cDNA:444bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens fragile histidine triad with C terminal Flag tag.
Sinónimo de gene:FRA3B, AP3Aase
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
( We provide with FHIT qPCR primers for gene expression analysis, HP103082 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14434-ACG$225
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14434-ACR$225
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14434-ANG$225
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14434-ANR$225
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14434-CF$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14434-CH$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14434-CM$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14434-CY$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de expressão)HG14434-G$75
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14434-NF$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14434-NH$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14434-NM$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14434-NY$195
Humano Fragile histidine triad / FHIT clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14434-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Fragile histidine triad, also known as FHIT, may play a key role in differentiating humans from apes. Fragile histidine triad gene belongs to the histidine triad gene family. It has been shown that fragile histidine triad synergizes with VHL, another tumor suppressor, in protecting against chemically - induced lung cancer. Fragile histidine triad gene works as a tumor suppressor as it has been demonstrated in animal studies. The exact molecular function of FHIT is still partially unclear. It also acts as a tumor suppressor of HER2/neu driven breast cancer.

  • Lambert N, et al. (2006) An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 443(7108):167-72.
  • Pekarsky Y, et al. (1998) Nitrilase and Fhit homologs are encoded as fusion proteins in Drosophila melanogaster and Caenorhabditis elegans. Proc Natl Acad Sci. 95(15):8744-9.
  • Ohta M, et al. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell. 84(4): 587-97.
  • Size / Price
    Catálogo: HG14434-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.