Encomenda rápida

Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano FGFR1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_023106.2
    Tamanho de cDNA:2196bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens fibroblast growth factor receptor 1 with C terminal Myc tag.
    Sinónimo de gene:CEK, FLG, FLT2, KAL2, BFGFR, CD331, FGFBR, HBGFR, N-SAM, FLJ99988
    Espécie:Human
    Vetor:pCMV3-C-Myc
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FGFR1 qPCR primers for gene expression analysis, HP100865 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10616-ACG$245
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10616-ACR$245
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10616-CF$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10616-CH$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10616-CM$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10616-CY$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de expressão)HG10616-M$75
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10616-NF$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10616-NH$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10616-NM$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10616-NY$215
    Humano FGFR1/CD331 transcript variant 4 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10616-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    FGFR1, also known as CD331, belongs to the fibroblast growth factor receptor subfamily where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. Fibroblast growth factors (FGFs) (FGF1 - 10 and 16 - 23) are mitogenic signaling molecules that have roles in angiogenesis, wound healing, cell migration, neural outgrowth and embryonic development. FGFs bind heparan sulfate glycosaminoglycans, which facilitates dimerization (activation) of FGF receptors. FGFR1 is a full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of FGFR1 interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. CD331 can be detected in astrocytoma, neuroblastoma and adrenal cortex cell lines. Some isoforms are detected in foreskin fibroblast cell lines, however isoform 17, isoform 18 and isoform 19 are not detected in these cells. Defects in FGFR1 are a cause of Pfeiffer syndrome ,idiopathic hypogonadotropic hypogonadism, Kallmann syndrome type 2, osteoglophonic dysplasia and trigonocephaly non-syndromic.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referências
  • Schlessinger J, et al. (2000) Crystal structure of a ternary FGF-FGFR-heparin complex reveals a dual role for heparin in FGFR binding and dimerization. Mol Cell. 6(3):743-50.
  • Dodé C, et al. (2007) Novel FGFR1 sequence variants in Kallmann syndrome, and genetic evidence that the FGFR1c isoform is required in olfactory bulb and palate morphogenesis. Hum Mutat. 28(1): 97-8.
  • Kim HG, et al. (2005) Hypogonadotropic hypogonadism and cleft lip and palate caused by a balanced translocation producing haploinsufficiency for FGFR1. J Med Genet. 42(8):666-72.
  • Size / Price
    Catálogo: HG10616-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"