After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Human FGFBP3 ORF mammalian expression plasmid, C-Flag tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FGFBP3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:777bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens fibroblast growth factor binding protein 3 with C terminal Flag tag.
Sinónimo de gene:FGF-BP3, C10orf13, MGC39320
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

FGFBP3 is a member of the fibroblast growth factor-binding protein family. Members of this family binds and activates FGF-1 and FGF-2, thereby contributing to tumor angiogenesis. Fibroblast growth factors (FGFs) are important regulators of cell migration, proliferation and differentiation, e.g., during embryogenesis and wound healing, and under several pathological conditions including tumor growth and tumor angiogenesis. Expression of FGF-BP increases after injury to murine and human skin, in particular in keratinocytes. This upregulation is most likely achieved by major keratinocyte mitogens present at the wound site. FGFBP3 is a positive regulator of fibroblast growth factor receptor signaling pathway and vascular permeability. It interacts with 2,3,7,8-tetrachlorodibenzodioxine, benzopyrene and valproic acid. FGFBP3 also exhibits fibroblast growth factor binding (orthology) and heparin binding (orthology).

  • Abuharbeid S, et al. (2006) The fibroblast growth factor-binding protein FGF-BP. Int J Biochem Cell Biol. 38(9):1463-8.
  • Lange LG, et al. (1976) Human liver alcohol dehydrogenase: purification, composition, and catalytic features. Biochemistry. 15(21):4687-93.
  • Czubayko F, et al. (1997) A secreted FGF-binding protein can serve as the angiogenic switch in human cancer. Nat Med. 3(10):1137-40.
  • Size / Price
    Catálogo: HG10986-CF
    Preço de catálogo:   (Save )
    Preço:      [How to order]
     Instruções de envio
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.