Encomenda rápida

Humano FAM19A2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FAM19A2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:396bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A2 with N terminal HA tag.
Sinónimo de gene:TAFA2, TAFA-2, MGC42403, DKFZp761E1217, DKFZp781P0552, FAM19A2
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano FAM19A2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Product nameProduct name

FAM19A2 belongs to the FAM19/TAFA family. FAM19/TAFA family members are chemokine-like proteins. The biological functions of TAFA family members remain to be determined, but there are a few tentative hypotheses. First, TAFAs may modulate immune responses in the CNS by functioning as brain specific chemokines, and may act with other chemokines to optimize the recruitment and activity of immune cells in the CNS. Second, TAFAs may represent a novel class of neurokines that act as regulators of immune nervous cells. And third, TAFAs may control axonal sprouting following brain injury. Human FAM19A2 is 97% aa identical to mouse FAM19A2 and is expressed in the central nervous system (CNS), colon, heart, lung, spleen, kidney, and thymus, however its expression in the CNS is 50 to 1000 fold higher than in other tissues. FAM19A2 gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins.

  • Parsa A, et al. (2011) Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. Clin Transl Sci. 4(1):17-23.
  • Rose JE, et al. (2010) Personalized smoking cessation: interactions between nicotine dose, dependence and quit-success genotype score. Mol Med. 16(7-8):247-53.
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • Size / Price
    Catálogo: HG11169-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.