Encomenda rápida

Humano FAM19A1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano FAM19A1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_213609.2
Tamanho de cDNA:402bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A1.
Sinónimo de gene:TAFA1, TAFA-1, FAM19A1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-FAM19A1
Local de restrição:KpnI + XbaI (6.1kb + 0.4kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FAM19A1 qPCR primers for gene expression analysis, HP101088 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano FAM19A1 Gene Plasmid Map
Human FAM19A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catálogo: HG11182-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry
Contact Us
Imagens
  • Human FAM19A1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"