Encomenda rápida

Text Size:AAA

Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human FABP4 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:399bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens fatty acid binding protein 4, adipocyte with N terminal HA tag.
Sinónimo de gene:aP2, A-FABP, FABP4
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12109-ACG$225
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12109-ACR$225
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12109-ANG$225
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12109-ANR$225
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12109-CF$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12109-CH$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12109-CM$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12109-CY$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de expressão)HG12109-M$75
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12109-NF$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12109-NH$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12109-NM$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12109-NY$195
Humano FABP4 /A-FABP clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12109-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Mouse fatty acid-binding protein, adipocyte, also known as Adipocyte-type fatty acid-binding protein, Fatty acid-binding protein 4, Adipocyte lipid-binding protein, and FABP4, is a cytoplasm protein which belongs to the calycin superfamily and Fatty-acid binding protein (FABP) family. In familial combined hyperlipidemia (FCHL), FABP4 correlated to body mass index (BMI), waist circumference and homeostasis model assessment (HOMA) index.FABP4 levels were associated with triglyceride-rich lipoproteins. In humans serum FABP4 levels correlate significantly with features of PCOS. It appears to be a determinant of atherogenic dyslipidemia. FABP4 pathway mediates the sebaceous gland hyperplasia in keratinocyte-specific Pten-null mice. FABP4 concentration significantly increased with an increasing of MS features and was strongly correlated with body-mass index, triglycerides, HDL-cholesterol concentrations and blood pressure. Patients in the highest quartile of FABP4 presented a six-fold increased odds ratio for MS and a three-fold increased odds for LD, adjusted by age, sex, body-mass index and the antiretroviral therapy. FABP4 is a strong plasma marker of metabolic disturbances in HIV-infected patients, and therefore, could serve to guide therapeutic intervention in this group of patients.

  • van Dongen,M.J. et al., 2002, J Am Chem Soc. 124 (40): 11874-80.
  • Coll, B. et al., 2008, Atherosclerosis  199 (1):147-53.
  • Hoashi,S. et al., 2008, BMC Genet. 9 :84.
  • Cai,H. et al., 2010, Bioorg Med Chem Lett  20 (12):3675-9.
  • Size / Price
    Catálogo: HG12109-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.