Encomenda rápida

Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano EZH2 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_004456.3
    Tamanho de cDNA:2256bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens enhancer of zeste homolog 2 (Drosophila).
    Sinónimo de gene:ENX1, EZH1, KMT6, ENX-1, KMT6A, MGC9169, EZH2
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:pCMV3-EZH2
    Local de restrição:KpnI + NotI (6.1kb + 2.26kb)
    Sequência de etiqueta:
    Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EZH2 qPCR primers for gene expression analysis, HP101222 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11337-ACG$245
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11337-ACR$245
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11337-ANG$245
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11337-ANR$245
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11337-CF$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11337-CH$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11337-CM$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11337-CY$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11337-M$75
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11337-NF$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11337-NH$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11337-NM$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11337-NY$215
    Humano EZH2/KMT6 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11337-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG11337-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"