After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Human ESD natural ORF mammalian expression plasmid

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ESD Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC001169
Tamanho de cDNA:849bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens esterase D.
Sinónimo de gene:RP11-147L20.1, FGH, FLJ11763, ESD
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

Esterase D, also known as ESD, is a serine hydrolase that belongs to the esterase D family. Esterase D is active toward numerous substrates including O-acetylated sialic acids, and it may be involved in the recycling of sialic acids. Esterase D gene is used as a genetic marker and a diagnostic tool for retinoblastoma, Wilson's disease and other hereditary or acquired diseases controlled by genes located at the 13 chromosome 13q14 region.

Referências
  • Lee EY, et al. (1986) Molecular cloning of the human esterase D gene, a genetic marker of retinoblastoma. Proc Natl Acad Sci. 83(17):6337-41.
  • Lee EY, et al. (1988) Human esterase D gene: complete cDNA sequence, genomic structure, and application in the genetic diagnosis of human retinoblastoma. Hum Genet. 79(2): 137-41.
  • Saito S, et al. (2003) Catalog of 680 variations among eight cytochrome p450 ( CYP) genes, nine esterase genes, and two other genes in the Japanese population. J Hum Genet. 48(5): 249-70.
  • Size / Price
    Catálogo: HG14252-UT
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade
     Instruções de envio
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"