Encomenda rápida

Humano EPDR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human EPDR1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:675bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ependymin related protein 1 (zebrafish) with N terminal His tag.
Sinónimo de gene:EPDR, UCC1, MERP1, MERP-1, EPDR1
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

EPDR1 is a member of the ependymin family. EPDR1 is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. It may play a role in calcium-dependent cell adhesion. EPDR1 is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8.

  • Suga T. et al., 2008, Int J Radiat Oncol Biol Phys. 72 (3): 808-13.
  • Rose JE. et al., 2010, Mol Med. 16 (7-8): 247-53.
  • Cheng W. et al., 2010, J Huazhong Univ Sci Technolog Med Sci. 30 (3): 391-6.
  • Size / Price
    Catálogo: HG13665-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.