After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano EPDR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human EPDR1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC018299
Tamanho de cDNA:675bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ependymin related protein 1 (zebrafish) with N terminal His tag.
Sinónimo de gene:EPDR, UCC1, MERP1, MERP-1, EPDR1
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fundo

EPDR1 is a member of the ependymin family. EPDR1 is a type II transmembrane protein that is similar to two families of cell adhesion molecules, the protocadherins and ependymins. It may play a role in calcium-dependent cell adhesion. EPDR1 is glycosylated, and the orthologous mouse protein is localized to the lysosome. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 8.

Referências
  • Suga T. et al., 2008, Int J Radiat Oncol Biol Phys. 72 (3): 808-13.
  • Rose JE. et al., 2010, Mol Med. 16 (7-8): 247-53.
  • Cheng W. et al., 2010, J Huazhong Univ Sci Technolog Med Sci. 30 (3): 391-6.
  • Size / Price
    Catálogo: HG13665-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"