Encomenda rápida

Text Size:AAA

Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ENO3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1305bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens enolase 3 (beta, muscle) with N terminal His tag.
Sinónimo de gene:GSD13, MSE, ENO3
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14270-ACG$225
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14270-ACR$225
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14270-ANG$225
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14270-ANR$225
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14270-CF$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14270-CH$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14270-CM$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14270-CY$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de expressão)HG14270-G$75
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14270-NF$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14270-NH$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14270-NM$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14270-NY$195
Humano ENO3 / beta-enolase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14270-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

ENO3 is one of the three enolase isoenzymes found in mammals. As a homodimer, ENO3 is found in skeletal muscle cells in the adult. A switch from alpha enolase to beta enolase occurs in muscle tissue during development in rodents. Mutations in ENO3 gene can be associated with metabolic myopathies that may result from decreased stability of the enzyme. Two transcripts have been identified for ENO3 gene that differ only in their 5' UTR. ENO3 may play a role in muscle development and regeneration. It appears to have a function in striated muscle development and regeneration.

  • Peshavaria M, et al. (1989) Structure of human muscle (beta) enolase mRNA and protein deduced from a genomic clone. Nucleic Acids Res. 17(21):8862.
  • Calì L, et al. (1990) Nucleotide sequence of a cDNA encoding the human muscle-specific enolase (MSE). Nucleic Acids Res. 18(7):1893.
  • Peshavaria M, et al. (1991) Molecular structure of the human muscle-specific enolase gene (ENO3). Biochem J. 275(2):427-33.
  • Size / Price
    Catálogo: HG14270-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.