Encomenda rápida

Text Size:AAA

Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human EIF2AK1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_014413.3
Tamanho de cDNA:1893bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation initiation factor 2-alpha kinase 1.
Sinónimo de gene:HCR, HRI, KIAA1369, EIF2AK1
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10663-ACG$245
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10663-ACR$245
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10663-ANG$245
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10663-ANR$245
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10663-CF$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10663-CH$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10663-CM$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10663-CY$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de expressão)HG10663-M$75
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10663-M-F$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10663-NF$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10663-NH$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10663-NM$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10663-NY$215
Humano eIF2AK1/HRI clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10663-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG10663-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"