Encomenda rápida

Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano EEF1E1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC005291
    Tamanho de cDNA:525bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 epsilon 1 with C terminal His tag.
    Sinónimo de gene:P18, AIMP3, EEF1E1
    Espécie:Human
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EEF1E1 qPCR primers for gene expression analysis, HP102660 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14004-ACG$225
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14004-ACR$225
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14004-ANG$225
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14004-ANR$225
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14004-CF$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14004-CH$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14004-CM$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14004-CY$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14004-G$75
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14004-NF$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14004-NH$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14004-NM$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14004-NY$195
    Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14004-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    EEF1E1, also known as AIMP3 and p18, is a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, EEF1E1 is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. It is comprised of a bifunctional glutamyl-prolyl-tRNA synthase, the monospecific isoleucyl, leucyl, glutaminyl, methionyl, lysyl, arginyl and aspartyl-tRNA synthases, and three auxiliary proteins, EEF1E1/p18, AIMP2/p38 and AIMP1/p43. EEF1E1 also plays a positive role in ATM/ATR-mediated p53 activation.

    Referências
  • Mao M. et al., 1998, Proc Natl Acad Sci. 95 (14): 8175-80.
  • Quevillon S. et al., 1999, J Mol Biol. 285 (1): 183-95.
  • Ahn HC. et al., 2003, FEBS Lett. 542 (1-3): 119-24.
  • Size / Price
    Catálogo: HG14004-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"