After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human EEF1E1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC005291
Tamanho de cDNA:525bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 epsilon 1 with C terminal His tag.
Sinónimo de gene:P18, AIMP3, EEF1E1
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14004-ACG$225
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14004-ACR$225
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14004-ANG$225
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14004-ANR$225
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14004-CF$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14004-CH$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14004-CM$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14004-CY$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14004-G$75
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14004-NF$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14004-NH$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14004-NM$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14004-NY$195
Humano EEF1E1 / AIMP3 / p18 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14004-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

EEF1E1, also known as AIMP3 and p18, is a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, EEF1E1 is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. It is comprised of a bifunctional glutamyl-prolyl-tRNA synthase, the monospecific isoleucyl, leucyl, glutaminyl, methionyl, lysyl, arginyl and aspartyl-tRNA synthases, and three auxiliary proteins, EEF1E1/p18, AIMP2/p38 and AIMP1/p43. EEF1E1 also plays a positive role in ATM/ATR-mediated p53 activation.

Referências
  • Mao M. et al., 1998, Proc Natl Acad Sci. 95 (14): 8175-80.
  • Quevillon S. et al., 1999, J Mol Biol. 285 (1): 183-95.
  • Ahn HC. et al., 2003, FEBS Lett. 542 (1-3): 119-24.
  • Size / Price
    Catálogo: HG14004-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"