After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human EEF1B2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC000211
Tamanho de cDNA:678bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens eukaryotic translation elongation factor 1 beta 2 with C terminal His tag.
Sinónimo de gene:EF1B, EEF1B, EEF1B1
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14611-ACG$225
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14611-ACR$225
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14611-ANG$225
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14611-ANR$225
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14611-CF$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14611-CH$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14611-CM$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14611-CY$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14611-G$75
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14611-NF$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14611-NH$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14611-NM$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14611-NY$195
Humano EF1B / EEF1B2 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14611-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

EF1B, also known as EEF1B2, is a translation elongation factor. It belongs to the EF-1-beta/EF-1-delta family. Elongation factors are a set of proteins that are used in protein synthesis in the cell. In the ribosome, they facilitate translational elongation, from the formation of the first peptide bond to the formation of the last one. EF1B is more complex in eukaryotes than in bacteria, and consists of three subunits: EF1B-alpha, EF1B-gamma and EF1B-beta. EF1B contains 1 GST C-terminal domain. It is involved in the transfer of aminoacylated tRNAs to the ribosome. EF1B is required to regenerate EF1A from its inactive form (EF1A-GDP) to its active form (EF1A-GTP). EF1A is then ready to interact with a new aminoacyl-tRNA to begin the cycle again.

Referências
  • Pizzuti A. et al., 1994, Biochem Biophys Res Commun. 197 (1): 154-62.
  • Rual. et al., 2005, Nature. 437 (7062): 1173-8.
  • Stelzl. et al., 2005, Cell. 122 (6): 957-68.
  • Sang Lee. et al., 2002, Biochem Biophys Res Commun. 291 (1): 158-64.
  • Size / Price
    Catálogo: HG14611-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"