After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human ECD Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC000721
Tamanho de cDNA:1935bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens ecdysoneless homolog (DrosophilA) with N terminal Myc tag.
Sinónimo de gene:GCR2, HSGT1, ECD
Espécie:Human
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14311-ACG$245
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14311-ACR$245
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14311-ANG$245
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14311-ANR$245
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14311-CF$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14311-CH$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14311-CM$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14311-CY$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de expressão)HG14311-G$75
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14311-NF$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14311-NH$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14311-NM$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14311-NY$215
Humano ECD / Ecdysoneless homolog clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14311-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

ECD, also known as ecdysoneless homolog, belongs to the SGT1 family. It is highly expressed in muscle and heart. ECD is a novel promoter of mammalian cell cycle progression. This function is related to its ability to remove the repressive effects of Rb-family tumor suppressors on E2F transcription factors. It is a novel tumor-promoting factor that is differentially expressed in pancreatic cancer and potentially regulates glucose metabolism within cancer cells. ECD may also be a transcriptional activator required for the expression of glycolytic genes.

Referências
  • Badzek S. et al., 2011, Wien Klin Wochenschr. 123 (23-24): 726-31.
  • Zhao X. et al., 2012, Breast Cancer Res Treat. 134 (1): 171-80.
  • Dey P. et al., 2012, Clin Cancer Res. 18 (22): 6188-98.
  • Size / Price
    Catálogo: HG14311-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"