Encomenda rápida

Humano EBI3 / IL27b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human EBI3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_005755.2
Tamanho de cDNA:690bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens Epstein-Barr virus induced 3 (EBI3) with N terminal His tag.
Sinónimo de gene:IL27B, EBI3
Espécie:Human
Vetor:pCMV3-SP-N-His
Plasmid:pCMV3-His-EBI3
Local de restrição:HindIII + XbaI (6kb + 0.72kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Human EBI3 Gene Plasmid Map
Human EBI3 / IL27b ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano EBI3 / IL27b clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: HG10117-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
  • Human EBI3 / IL27b ORF mammalian expression plasmid, N-His tag
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"