Encomenda rápida

Humano RCAS1 / EBAG9 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano EBAG9 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC017729
Tamanho de cDNA:642bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens estrogen receptor binding site associated, antigen, 9 with C terminal His tag.
Sinónimo de gene:EB9, PDAF, RCAS1, EBAG9
Espécie:Human
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with EBAG9 qPCR primers for gene expression analysis, HP102668 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fundo

RCAS1, also known as EBAG9, is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. RCAS1 gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor which binds to the estrogen-responsive element (ERE) found in the 5'-flanking region of RCAS1 gene. Two transcript variants differing in the 5' UTR, but encoding the same protein, have been identified for RCAS1 gene. EBAG9 may participate in suppression of cell proliferation and induces apoptotic cell death through activation of interleukin-1-beta converting enzyme (ICE)-like proteases.

Referências
  • Ohshima K. et al., 2001, Clin Exp Immunol. 123 (3): 481-6.
  • Ikeda K. et al., 2000, Biochem Biophys Res Commun. 273 (2): 654-60.
  • Nakashima M. et al., 1999, Nat Med. 5 (8): 938-42.
  • Size / Price
    Catálogo: HG14012-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"