After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human DPYS Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC034395
Tamanho de cDNA:1561bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens dihydropyrimidinase with N terminal Myc tag.
Sinónimo de gene:DHP, DHPase
Espécie:Human
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14884-ACG$245
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14884-ACR$245
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14884-ANG$245
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14884-ANR$245
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14884-CF$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14884-CH$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14884-CM$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14884-CY$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de expressão)HG14884-G$75
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14884-NF$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14884-NH$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14884-NM$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14884-NY$215
Humano DPYS / Dihydropyrimidinase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14884-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

DPYS, also known as dihydropyrimidinase, belongs to the DHOase family, hydantoinase/dihydropyrimidinase subfamily. DPYS catalyzes the second step of the reductive pyrimidine degradation, the reversible hydrolytic ring opening of dihydropyrimidines. It can catalyzes the ring opening of 5,6-dihydrouracil to N-carbamyl-alanine and of 5,6-dihydrothymine to N-carbamyl-amino isobutyrate. DPYS is expressed at a high level in liver and kidney as a major 2.5-kb transcript and a minor 3.8-kb transcript. Defects in the DPYS gene are linked to dihydropyrimidinuria.

Referências
  • Thomas HR. et al., 2008, Genomics. 18 (1): 25-35.
  • Thomas HR. et al., 2008, Pharmacogenet Genomics. 17 (11): 973-87.
  • Van Kuilenburg AB. et al., 2007, Mol Genet Metab. 91 (2): 157-64.
  • Size / Price
    Catálogo: HG14884-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"