Encomenda rápida

Humano dehydropeptidase-I / DPEP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano DPEP1 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1236bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens dipeptidase 1 (renal) with C terminal Myc tag.
    Sinónimo de gene:MDP, RDP, MBD1, DPEP1
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with DPEP1 qPCR primers for gene expression analysis, HP102229 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano dehydropeptidase-I / DPEP1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
    Product nameProduct name

    Dehydropeptidase-I, also known as DPEP1, is a kidney membrane enzyme. Its expression in normal colonic mucosa is very low, but it is highly expressed in colorectal adenoma and cancer specimens and is negatively correlated with parameters of pathological aggressiveness and poor prognosis. The overexpression of DPEP1 suppressed tumor cells invasiveness and increased sensitivity to chemotherapeutic agent Gemcitabine. Growth factor EGF treatment decreased DPEP1 expression. Dehydropeptidase-I may be a candidate target in PDAC for designing improved treatments. It uses zinc as a cofactor and acts as a disulfide-linked homodimer.

  • Toiyama Y. et al., 2011, J Gastroenterol. 46 (2): 153-63.
  • Zhang G. et al., 2012, PLoS One. 7 (2): e31507.
  • Okamoto T. et al., 2011, Mod Pathol. 24 (2): 267-76.
  • Size / Price
    Catálogo: HG13543-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.