After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human TRDMT1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_004412.4
Tamanho de cDNA:1176bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens tRNA aspartic acid methyltransferase 1 with N terminal Flag tag.
Sinónimo de gene:DMNT2, DNMT2, PuMet, RNMT1, M.HsaIIP, TRDMT1
Espécie:Human
Vetor:pCMV3-N-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG11224-ACG$225
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG11224-ACR$225
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG11224-ANG$225
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG11224-ANR$225
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG11224-CF$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG11224-CH$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG11224-CM$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG11224-CY$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG11224-M$75
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG11224-NF$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG11224-NH$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG11224-NM$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG11224-NY$195
Humano DNMT2 / TRDMT1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG11224-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

DNMT2, also known as tRNA (cytosine-5-)-methyltransferase, DNA methyltransferase homolog HsaIIP, and TRDMT1, is a member of the DNA methyltransferase family of enzymes. DNMT2 enzymes have been widely conserved during evolution and contain all of the signature motifs of DNA (cytosine-5)-methyltransferases. It contains all 10 sequence motifs that are conserved among m(5)C MTases, including the consensus S:-adenosyl-L-methionine-binding motifs and the active site ProCys dipeptide, and its structure is very similar to prokaryotic DNA methyltransferases. DNMT2 has close homologs in plants, insects and Schizosaccharomyces pombe, but no related sequence can be found in the genomes of Saccharomyces cerevisiae or Caenorhabditis elegans. While the biological function of DNMT2 is not yet known, the strong binding to DNA suggests that DNMT2 may mark specific sequences in the genome by binding to DNA through the specific target-recognizing motif. However, the DNA methyltransferase activity of these proteins is comparatively weak and their biochemical and functional properties remain enigmatic. Recent evidence now shows that Dnmt2 has a novel tRNA methyltransferase activity, raising the possibility that the biological roles of these proteins might be broader than previously thought.

Referências
  • Dong A, et al. (2001) Structure of human DNMT2, an enigmatic DNA methyltransferase homolog that displays denaturant-resistant binding to DNA. Nucleic Acids Res. 29(2): 439-48.
  • Hermann A, et al. (2003) The human Dnmt2 has residual DNA-(cytosine-C5) methyltransferase activity. J Biol Chem. 278(34): 31717-21.
  • Jeltsch A, et al. (2006) Two substrates are better than one: dual specificities for Dnmt2 methyltransferases. Trends Biochem Sci. 31(6): 306-8.
  • Schaefer M, et al. (2010) Solving the Dnmt2 enigma. Chromosoma. 119(1): 35-40.
  • Size / Price
    Catálogo: HG11224-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"