After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human DIRAS3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC005362
Tamanho de cDNA:690bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens DIRAS family, GTP-binding RAS-like 3.
Sinónimo de gene:ARHI, NOEY2, DIRAS3
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14239-ACG$225
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14239-ACR$225
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14239-ANG$225
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14239-ANR$225
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14239-CF$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14239-CH$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14239-CM$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14239-CY$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14239-G$75
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14239-NF$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14239-NH$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14239-NM$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14239-NY$195
Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14239-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, ARHI is not only an important factor in the pathogenesis of gastric cancer, but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease.

Referências
  • Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24.
  • Lin D. et al., 2011, J Int Med Res. 39 (5): 1870-5.
  • Wang W. et al., 2012, Oncol Rep. 27 (6): 1953-9.
  • Size / Price
    Catálogo: HG14239-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"