Encomenda rápida

Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano DIRAS3 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC005362
    Tamanho de cDNA:690bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens DIRAS family, GTP-binding RAS-like 3.
    Sinónimo de gene:ARHI, NOEY2, DIRAS3
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with DIRAS3 qPCR primers for gene expression analysis, HP102889 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG14239-ACG$225
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG14239-ACR$225
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG14239-ANG$225
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG14239-ANR$225
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG14239-CF$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG14239-CH$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG14239-CM$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG14239-CY$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de expressão)HG14239-G$75
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG14239-NF$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG14239-NH$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG14239-NM$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG14239-NY$195
    Humano ARHI / DIRAS3 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG14239-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    ARHI, also known as DIRAS3, belongs to the small GTPase superfamily, Di-Ras family. ARHI gene is a novel tumor suppressor gene located on chromosome 1p31. Downregulation of ARHI expression has been detected in many types of cancer. ARHI is expressed in normal ovarian and breast epithelial cells but not in ovarian and breast cancers. As a suppressor, ARHI is not only an important factor in the pathogenesis of gastric cancer, but also a potential factor for tumor aggravation. ARHI expression in gastric cancer can be employed to indicate favorable prognosis for the disease.

    Referências
  • Pei XH. et al., 2011, Cell Biol Int. 35 (10): 1019-24.
  • Lin D. et al., 2011, J Int Med Res. 39 (5): 1870-5.
  • Wang W. et al., 2012, Oncol Rep. 27 (6): 1953-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"