Encomenda rápida

Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human DBI Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC062996
Tamanho de cDNA:315bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) DNA.
Sinónimo de gene:EP, ACBP, ACBD1, CCK-RP
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15211-ACG$225
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15211-ACR$225
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15211-ANG$225
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15211-ANR$225
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15211-CF$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15211-CH$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15211-CM$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15211-CY$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG15211-G$75
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15211-NF$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15211-NH$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15211-NM$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15211-NY$195
Humano DBI / ACBD1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15211-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG15211-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"