After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human DBH Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1812bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens dopamine beta-hydroxylase (dopamine beta-monooxyge) with C terminal HA tag.
Sinónimo de gene:DBM, DBH
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13440-ACG$245
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13440-ACR$245
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG13440-ANG$245
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG13440-ANR$245
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13440-CF$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13440-CH$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13440-CM$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13440-CY$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de expressão)HG13440-G$75
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13440-NF$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13440-NH$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13440-NM$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13440-NY$215
Humano DBH / Dopamine beta-Hydroxylase clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13440-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

DBH is a 290 kDa copper-containing oxygenase. It can be detected in noradrenergic nerve terminals of the central and peripheral nervous systems, and is also expressed in chromaffin cells of the adrenal medulla. DBH contains our identical subunits, and its activity requires ascorbate as a cofactor. It functions in in the synthesis of small-molecule neurotransmitters that is membrane-bound, making norepinephrine the only transmitter synthesized inside vesicles. DBH has been shown to be associated with decision making and addictive behaviors such as alcohol and smoking, attention deficit hyperactivity disorder, and also with neurological diseases such as Schizophrenia and Alzheimer's.

  • Rush RA. et al., 1980, Crit Rev Clin Lab Sci. 12 (3): 241-77.
  • Goldstein M. et al., 1964, Life Sci. 3 (7): 763-7.
  • S Friedman. et al., 1966, The Journal of Biological Chemistry. 241 (10): 2256-9.
  • Size / Price
    Catálogo: HG13440-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.