Encomenda rápida

Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human DAPK3 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001348.1
Tamanho de cDNA:1365bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens death-associated protein kinase 3 with N terminal His tag.
Sinónimo de gene:ZIP, ZIPK, FLJ36473, DAPK3
Espécie:Human
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10757-ACG$225
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10757-ACR$225
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10757-ANG$225
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10757-ANR$225
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10757-CF$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10757-CH$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10757-CM$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10757-CY$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de expressão)HG10757-M$75
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10757-M-F$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10757-NF$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10757-NH$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10757-NM$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10757-NY$195
Humano DAPK3/ZIPK clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10757-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Death-associated protein kinase 3, also known as DAP kinase 3, ZIP-kinase, DAPK3 and ZIPK, is a nucleus and cytoplasm protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and DAP kinase subfamily. DAPK3 / ZIPK contains one protein kinase domain. It is a serine/threonine kinase which acts as a positive regulator of apoptosis. It phosphorylates histone H3 on 'Thr-11' at centromeres during mitosis. DAPK3 / ZIPK is a homodimer or forms heterodimers with ATF4. Both interactions require an intact leucine zipper domain and oligomerization is required for full enzymatic activity. It also binds to DAXX and PAWR, possibly in a ternary complex which plays a role in caspase activation. DAPK3 / ZIPK regulates myosin light chain phosphatase through phosphorylation of MYPT1 thereby regulating the assembly of the actin cytoskeleton, cell migration, invasiveness of tumor cells, smooth muscle contraction and neurite outgrowth. It is involved in the formation of promyelocytic leukemia protein nuclear body (PML-NB), one of many subnuclear domains in the eukaryotic cell nucleus, and which is involved in oncogenesis and viral infection.

Referências
  • Kawai T., et al., 1998, Mol. Cell. Biol. 18:1642-1651.
  • Murata-Hori M., et al., 1999, FEBS Lett. 451:81-84.
  • Kawai T., et al., 2003, Mol. Cell. Biol. 23:6174-6186.
  • Greenman C., et al., 2007, Nature 446:153-158.
  • Ohbayashi N., et al., 2008, Biochem. Biophys. Res. Commun. 372: 708 -712.
  • Size / Price
    Catálogo: HG10757-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"