After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CSTA Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_005213.3
Tamanho de cDNA:297bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cystatin A (stefin A) with C terminal HA tag.
Sinónimo de gene:STF1, STFA, CSTA
Espécie:Human
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10479-ACG$225
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10479-ACR$225
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10479-ANG$225
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10479-ANR$225
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10479-CF$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10479-CH$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10479-CM$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10479-CY$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de expressão)HG10479-M$75
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10479-NF$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10479-NH$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10479-NM$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10479-NY$195
Humano Cystatin A / CSTA clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10479-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Cystatin-A, also known as Cystatin-AS, Stefin-A and CSTA, is a cytoplasm protein which belongs to the cystatin family. Cystatin-A / CSTA is a cysteine proteinase inhibitor with a molecular mass of 11 kDa, and is located mainly in the keratohyaline granules of the stratum granulosum and the cornified envelope of the stratum corneum in the epidermis. The cystatins are a family of cysteine protease inhibitors with homology to chicken cystatin. Cystatins are physiological inhibitors of cysteine proteinases which are widely distributed in human tissues and fluids. Cystatins typically comprise about 115 amino acids, are largely acidic, contain four conserved cysteine residues known to form two disulfide bonds. Cystatins may be glycosylated and / or phosphorylated, with similarity to fetuins, kininogens, stefins, histidine-rich glycoproteins and cystatin-related proteins. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired inhibitory activity. Cystatins mainly inhibit peptidases belonging to peptidase families C1 (papain family) and C13 (legumain family).

Size / Price
Catálogo: HG10479-CY
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"