Encomenda rápida

Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CAMK4 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001744.4
Tamanho de cDNA:1422bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV.
Sinónimo de gene:CaMK-GR, MGC36771, CAMK4
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG10664-ACG$225
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG10664-ACR$225
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG10664-ANG$225
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG10664-ANR$225
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10664-CF$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG10664-CH$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG10664-CM$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG10664-CY$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de expressão)HG10664-M$75
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG10664-M-F$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10664-M-N$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG10664-NF$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG10664-NH$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG10664-NM$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG10664-NY$195
Humano CaM Kinase 4/CaMKIV clonagem de ADN ou de clonagem do gene (vector de clonagem)HG10664-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

Referências
  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Catálogo: HG10664-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"