Encomenda rápida

Text Size:AAA

Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CYP2D6 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_000106.4
Tamanho de cDNA:1494bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cytochrome P450, family 2, subfamily D, polypeptide 6.
Sinónimo de gene:CPD6, CYP2D, CYP2DL1, CYPIID6, P450C2D, P450DB1, CYP2D7AP, CYP2D7BP, CYP2D7P2, CYP2D8P2, P450-DB1, MGC120389, MGC120390, CYP2D6
Espécie:Human
Vetor:pCMV3-untagged
Plasmid:pCMV3-CYP2D6
Local de restrição:KpnI + XbaI (6.1kb + 1.49kb)
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG12022-ACG$225
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG12022-ACR$225
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG12022-ANG$225
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG12022-ANR$225
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG12022-CF$195
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG12022-CH$215
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG12022-CM$215
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG12022-CY$215
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de expressão)HG12022-G$75
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG12022-NF$195
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG12022-NH$195
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG12022-NM$195
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG12022-NY$195
Humano CYP2D6/Cytochrome P450 2D6 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG12022-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: HG12022-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
DisponibilidadeIn Stock
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"