Encomenda rápida

Humano CXCL2/MIP-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CXCL2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:324bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens chemokine (C-X-C motif) ligand 2 with C terminal Myc tag.
Sinónimo de gene:GRO2, GROb, MIP2, MIP2A, SCYB2, MGSA-b, MIP-2a, CINC-2a
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano CXCL2/MIP-2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
Product nameProduct name

Chemokine (C-X-C motif) ligand 2 (CXCL2), also called macrophage inflammatory protein 2 (MIP-2), Growth-regulated protein beta (Gro-beta) and Gro oncogene-2 (Gro-2), is a small cytokine belonging to the CXC chemokine family. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for CXCL2/MIP-2 or in the presence of a blocking Ab to CXCL2/MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. CXCL2/MIP-2 is selectively up-regulated in tolerance-conferring APCs and serves to recruit NKT cells to the splenic marginal zone, where they form clusters with APCs and T cells. In the absence of the high-affinity receptor for MIP-2 (as in CXCR2-deficient mice) or in the presence of a blocking Ab to MIP-2, peripheral tolerance is prevented, and Ag-specific T regulatory cells are not generated. Understanding the regulation of lymphocyte traffic during tolerance induction may lead to novel therapies for autoimmunity, graft acceptance, and tumor rejection. Several studies have implicated the CXCL2 chemokine as a mediator in the development of sepsis. CXCL2/MIP-2 also plays a major role in mediating the neutrophilic inflammatory response of the rodent lung to particles such as quartz, crocidolite asbestos, as well as high doses of other relative innocuous dusts such as titanium dioxide.

  • Driscoll KE. (2000) TNFalpha and MIP-2: role in particle-induced inflammation and regulation by oxidative stress. Toxicol Lett. 112-113: 177-83.
  • Walpen S, et al. (2001) Nitric oxide induces MIP-2 transcription in rat renal mesangial cells and in a rat model of glomerulonephritis. FASEB J. 15(3): 571-3.
  • Fahey TJ, et al. (1990) Cytokine production in a model of wound healing: the appearance of MIP-1, MIP-2, cachectin/TNF and IL-1. Cytokine. 2(2): 92-9.
  • Size / Price
    Catálogo: HG10586-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.