Encomenda rápida

Humano CXADR / CAR clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

  • Human CXADR natural ORF mammalian expression plasmid, N-Myc tag
Folha de dadosAnálisesProdutos relacionadosProtocolos
Humano CXADR Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001338.3
Tamanho de cDNA:1098bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens coxsackie virus and adenovirus receptor with N terminal Myc tag.
Sinónimo de gene:CAR, HCAR
Espécie:Human
Vetor:pCMV3-SP-N-Myc
Plasmid:pCMV3-Myc-CXADR
Local de restrição:KpnI + XbaI (6kb + 1.13kb)
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with CXADR qPCR primers for gene expression analysis, HP100713 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Humano CXADR Gene Plasmid Map
Human CXADR natural ORF mammalian expression plasmid, N-Myc tag
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fundo

CXADR (coxsackie virus and adenovirus receptor), also known as CAR, is a type I  transmembrane glycoprotein belonging to the CTX family of the Ig superfamily, and is essential for normal cardiac development in the mouse. Proposed as a homophilic cell adhesion molecule, CXADR is a component of the epithelial apical junction complex that is essential for the tight junction integrity, and probably involved in transepithelial migration of polymorphonuclear leukocytes (PMN). Mature mouse CXADR structrually comprises a 218 aa extracellular domain (ECD) with a V-type (D1) and a C2-type (D2) Ig-like domain, a 21 aa transmembrane segment and a 107 aa intracellular domain, among which,D1 is thought to be responsible for homodimer formation in trans within tight junctions. The ECD of mouse CXADR shares 97%, 90% sequence identity with the corresponding regions of rat, human CXADR.

Referências
  • Tomko, R.P. et al., 1997, Proc. Natl. Acad. Sci. U.S.A. 94 (7): 3352–3356.
  • van Raaij , M.J. et al., 2001, Structure. 8 (11): 1147–1155.
  • Cohen, C.J. et al., 2001, J. Biol. Chem. 276 (27): 25392–25398.
  • Carson, S.D. et al., 2002, Rev. Med. Virol. 11 (4): 219–226.
  • Selinka, H.C. et al., 2004, Med. Microbiol. Immunol. 193 (2-3): 127–131.
  • Philipson, L. et al., 2004, Curr. Top. Microbiol. Immunol. 273:87-111.
  • Raschperger, E. et al., 2006, Exp. Cell Res. 312: 1566-1580.
  • Size / Price
    Catálogo: HG10799-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"