Encomenda rápida

Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano CUL5 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC063306
    Tamanho de cDNA:2343bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens cullin 5.
    Sinónimo de gene:VACM1, VACM-1
    Espécie:Human
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CUL5 qPCR primers for gene expression analysis, HP103829 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15203-ACG$245
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15203-ACR$245
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15203-ANG$245
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15203-ANR$245
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15203-CF$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15203-CH$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15203-CM$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15203-CY$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de expressão)HG15203-G$75
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15203-NF$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15203-NH$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15203-NM$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15203-NY$215
    Humano Cullin 5 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15203-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG15203-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"