Encomenda rápida

Humano CTSZ / CTSX / Cathepsin Z clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CTSZ Informações sobre o produto de clone de cDNA
Tamanho de cDNA:912bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cathepsin Z with N terminal Myc tag.
Sinónimo de gene:CTSZ, CTSX, FLJ17088
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano CTSZ / CTSX / Cathepsin Z clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name

Cathepsin Z (CTSZ), also known as Cathepsin X or CATX, belongs to the C1 family of lysosomal cysteine proteases. Its gene structure and activity properties show several unique features that distinguish it clearly from other human cysteine proteases. It has a very short pro-region that shows no similarity to those of other cathepsins and a three-residue insertion motif that forms a characteristic ‘mini loop’. Cathepsin Z exhibits mono- and di-peptidase activity at its C-terminus, and in contrast to cathepsin B, it does not act as an endopeptidase. It is restricted to the cells of theimmune system, predominantly monocytes, macrophages and dendritic cells. Cathepsin Z is widely expressed in human tissues, suggesting that this enzyme could be involved in the normal intracellular protein degradation taking place in all cell types. It is capable to cleave regulatory motifs at C-terminus affecting the function of targeted molecules. Cathepsin X may regulate also the maturation of dendritic cells, a process, which is crucial in the initiation of adaptive immunity. Furthermore, higher levels of Cathepsin Z are also found in tumour and immune cells of prostate and gastric carcinomas and inmacrophages of gastric mucosa, especially after infection by Helicobacter pylori. Cathepsin Z is also ubiquitously distributed in cancer cell lines and in primary tumors from different sources, suggesting that this enzyme may participate in tumor progression.

  • Santamara I, et al. (1998) Cathepsin Z, a novel human cysteine proteinase with a short propeptide domain and a unique chromosomal location. J Biol Chem. 273(27): 16816-23.
  • Kos J, et al. (2009) The role of cathepsin X in cell signaling. Cell Adh Migr. 3(2): 164-6.
  • Sevenich L, et al. (2010) Synergistic antitumor effects of combined cathepsin B and cathepsin Z deficiencies on breast cancer progression and metastasis in mice. Proc Natl Acad Sci U S A. 107(6): 2497-502.
  • Size / Price
    Catálogo: HG10159-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.