Encomenda rápida

Humano Cathepsin L/CTSL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CTSL1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1002bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens cathepsin L1 with C terminal HA tag.
Sinónimo de gene:MEP, CATL, CTSL, FLJ31037, CTSL1
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Humano Cathepsin L/CTSL1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Product nameProduct name

Cathepsin L is a lysosomal cysteine protease that plays a major role in intracellular protein catabolism, and is potent in degrading collagen, laminin, elastin, as well as alpha-1 protease inhibitor and other structural proteins of basement membranes. It is secreted by liver flukes at all stages of their development in the mammalian host, are believed to play important roles in facilitating parasite migration (tissue degradation), feeding and immuno-evasion. Like many proteases, Cathepsin L is synthesized as an inactive preproenzyme, and cleavage of the 96-residue proregion is necessary to generate the fully active 221-residue mature enzyme. Studies have demonstrated that cleavage of the proregion occur autocatalytically under acidic conditions. The enzyme takes part in nutrient acquisition by catabolizing host proteins to absorbable peptides, facilitates the migration of the parasite through the host intestine and liver by cleaving interstitial matrix proteins such as fibronectin, laminin and native collagen and is implicated in the inactivation of host immune defenses by cleaving immunoglobulins. Recently, Cathepsin L has been shown to suppress Th1 immune response in infected laboratory animals making them susceptible to concurrent bacterial infections. Cathepsin L is synthesized in large amounts and secreted by many malignantly transformed cells, and induced by growth factors and tumor promoters. In addition to its role in protein degradation, evidence has accumulated for the participation of Cathepsin L in various physiological and pathological processes, such as tumor invasion and metastasis, bone resorption, spermatogenesis, and arthritis. Accordingly, Cathepsin L may prove useful as a diagnostic or prognostic marker of human tumor malignancy.

  • Mulcahy G, et al. (2001) Cathepsin L proteinases as vaccines against infection with Fasciola hepatica (liver fluke) in ruminants. Res Vet Sci. 70(1): 83-6.
  • Dixit AK, et al. (2008) Immunodiagnostic/protective role of cathepsin L cysteine proteinases secreted by Fasciola species. Vet Parasitol. 154(3-4): 177-84.
  • Leto G, et al. (2010) Cathepsin L in metastatic bone disease: therapeutic implications. Biol Chem. 391(6): 655-64.
  • Size / Price
    Catálogo: HG10486-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.