After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CTRL Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC063475
Tamanho de cDNA:795bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens chymotrypsin-like with N terminal Myc tag.
Sinónimo de gene:CTRL1, MGC70821, CTRL
Espécie:Human
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG13748-ACG$225
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG13748-ACR$225
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG13748-CF$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG13748-CH$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG13748-CM$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG13748-CY$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de expressão)HG13748-G$75
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG13748-NF$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG13748-NH$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG13748-NM$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG13748-NY$195
Humano CTRL-1 / Chymotrypsin-like protease clonagem de ADN ou de clonagem do gene (vector de clonagem)HG13748-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

CTRL-1, also known as chymotrypsin-like protease, belongs to the peptidase S1 family. CTRL-1 contains 1 peptidase S1 domain. Its expression is increased in preeclampsia (PE). Placental-derived chymotrypsin-like protease is responsible for inducing endothelial inflammatory phenotypic changes possibly by upregulation of cell adhesion molecule expressions, activation of cellular protease, and induction of extracellular regulated kinase phosphorylation. Activated microglia have been observed in various neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis, and multiple sclerosis. Five structurally distinct inhibitors that are known to inhibit chymotrypsin-like proteases were partially protective. They might represent a novel class of drugs with benefit in diseases where overactivity of microglia contributes to the pathogenesis.

Referências
  • Yang Gu. et al., 2009, Reprod Sci. 16 (9): 905-13.
  • Klegeris A. et al., 2005, Glia. 51 (1):56-64.
  • Caroline V. Bamford. et al., 2007, nfect Immun. 75 (9): 4364-72.
  • Size / Price
    Catálogo: HG13748-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"