After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Humano CTHRC1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human CTHRC1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:732bp
Descrição de cDNA:Full length Clone DNA of Homo sapiens collagen triple helix repeat containing 1 with C terminal Flag tag.
Sinónimo de gene:CTHRC1
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein that is glycosylated and highly conserved from lower chordates to mammals. CTHRC1 expression was not detectable in normal arteries. However, it is transiently expressed in the arterial wall in response to injury where it may contribute to vascular remodeling by limiting collagen matrix deposition and promoting cell migration. A short collagen motif with 12 Gly-X-Y repeats appears to be responsible for trimerization of the CTHRC1 protein and this renders the molecule susceptible to cleavage by collagenase. CTHRC1 overexpression caused a dramatic reduction in collagen type I mRNA and protein levels. Currently available data indicate that Cthrc1 expression in vascular cells regulates transforming growth factor beta responsiveness, thereby impacting transforming growth factor beta target genes, including collagens. Additionally, CTHRC1 increases bone mass as a positive regulator of osteoblastic bone formation and offers an anabolic approach for the treatment of osteoporosis.

  • Pyagay P, et al. (2005) Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res. 96(2): 261-8.
  • Durmus T, et al. (2006) Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1). Gene Expr Patterns. 6(8): 935-40.
  • LeClair R, et al. (2007) The role of collagen triple helix repeat containing 1 in injured arteries, collagen expression, and transforming growth factor beta signaling. Trends Cardiovasc Med. 17(6): 202-5.
  • Kimura H, et al. (2008) Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One. 3(9): e3174.
  • Size / Price
    Catálogo: HG11647-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.