Encomenda rápida

Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano CTCFL Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC130486
    Tamanho de cDNA:1992bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens CCCTC-binding factor (zinc finger protein)-like with C terminal His tag.
    Sinónimo de gene:CT27, BORIS, CTCF-T, HMGB1L1, dJ579F20.2
    Espécie:Human
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTCFL qPCR primers for gene expression analysis, HP104344 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15751-ACG$245
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15751-ACR$245
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15751-ANG$245
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15751-ANR$245
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15751-CF$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15751-CH$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15751-CM$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15751-CY$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de expressão)HG15751-G$75
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15751-NF$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15751-NH$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15751-NM$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15751-NY$215
    Humano CTCFL/BORIS clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15751-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: HG15751-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"