Encomenda rápida

Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Humano CTAG1A Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:BC130362
    Tamanho de cDNA:543bp
    Descrição de cDNA:Full length Clone DNA of Homo sapiens cancer/testis antigen 1A with C terminal Myc tag.
    Sinónimo de gene:ESO1, LAGE2A
    Espécie:Human
    Vetor:pCMV3-C-Myc
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CTAG1A qPCR primers for gene expression analysis, HP104230 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaHG15611-ACG$225
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaHG15611-ACR$225
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaHG15611-ANG$225
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaHG15611-ANR$225
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaHG15611-CF$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaHG15611-CH$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaHG15611-CM$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaHG15611-CY$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de expressão)HG15611-G$75
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaHG15611-NF$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaHG15611-NH$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaHG15611-NM$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaHG15611-NY$195
    Humano NY-ESO-1 clonagem de ADN ou de clonagem do gene (vector de clonagem)HG15611-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    NY-ESO-1 is another well-characterized CT antigen that appears to be the most immunogenic CT antigen known to date. Integrated humoral and cellular immune response against NY-ESO-1 are frequently observed in patients with tumors with NY-ESO-1 expression. As a member of CT antigens, NY-ESO-1 is expressed in a variety of malignant neoplasms, including melanomas, and esophageal, breast, prostate, urinary tract, ovarian, and lung cancers. Recently, immunohistochemical and molecular analytical approaches for the detection of NY-ESO-1 expression were compared, defining the reliability of each method. However, its clinical significance, e.g. in prognosis, in lung cancer is unclear.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referências
  • Yoshida N, Abe H, Ohkuri T, et al. Expression of the MAGE-A4 and NY-ESO-1 cancer-testis antigens and T cell infiltration in non-small cell lung carcinoma and their prognostic significance[J]. International journal of oncology, 2006, 28(5): 1089-1098.
  • Size / Price
    Catálogo: HG15611-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"